t4 dna ligase cloning kit (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
97
Structured Review
TaKaRa
t4 dna ligase cloning kit
T4 Dna Ligase Cloning Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 7355 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t4+ligase/T4+DNA+Ligase/pmc12859213-71-109-114
Average 97 stars, based on 7355 article reviews
T4 Dna Ligase Cloning Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 7355 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/t4+ligase/T4+DNA+Ligase/pmc12859213-71-109-114
Average 97 stars, based on 7355 article reviews
t4 dna ligase cloning kit - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Compact Cas12f enables genome editing in avian cells Article Snippet: For Cas9-mediated editing, the plasmids pSpCas9(BB)-2A-GFP (PX458) (#48138, Addgene, MA, USA) and pSpCas9(BB)-2A-Puro (PX459) (#48139, Addgene) were used. .. For Cas12f-mediated editing, the plasmid Cas12f-GE ver4.1(_GFP) (#176544, Addgene) was used, and the Cas12f-GE ver4.1_Puro was generated by replacing the GFP cassette with a puromycin resistance gene through digestion and ligation using EcoRI restriction enzyme (#R0101L, New England Biolabs, MA, USA) and Article Title: Maize gene ZmRAVL1 and functional site and use thereof Article Snippet: RNAi Targeting Sequences: (SEQ ID No: 45) GGACGAGGAGGAAGAGCAGGAGGAAGAGGAGGAGGAGGAGGAGGCGTCT CCGCGCGAGATCCCCTTCATGACAGCGGCAGCGACGGCCGACACCGGAG CCGCCGCCTCCTCGTCCTCGCCTTCCGCGGCGGCCTCATCGGGTCCTGC TGCTGCCCCCCGCTCGAGCGACGGCGCCGGGGCGTCCGGGAGCGGCGGC GGCGGGAGCGACGACGTGCAGGTGATCGAGAAGGA Primer Names and Sequences RNAi-1-F (SEQ ID No: 46) CGGGATCCCCATGGGGACGAGGAGGAAGAGCA RNAi-1-R (SEQ ID No: 47) GGACTAGTTCCTTCTCGATCACCTGCAC RNAi-2-F (SEQ ID No: 48) GAAGATCTGGTTACCGGACGAGGAGGAAGAGCA RNAi-2-R (SEQ ID No: 49) GCTCTAGATCCTTCTCGATCACCTGCAC (2) E. coli was used to amplify and propagate the P1022 plasmid, and the Bgl II and Xba I (Takara) double digestion system was used to digest the P1022 plasmid and antisense fragments. .. The double digestion system was as follows: Ingredients Amount added plasmid/DNA fragment 5 μg Bgl II 5 μL Xba I 5 μL 10 × T 20 μL ddH2O To 100 μL It was incubated for more than 3 hours in a 37° C. water bath. (3) The digested product was purified using a purification kit (OMEGA), and the antisense fragment was introduced into the P1022 vector using Article Title: Improvement of chicken genome editing efficiency in vitro using ribonucleoprotein-mediated CRISPR/Cas9 delivery. Article Snippet: gRNAs targeting DAZL and STRA8 were designed based on sequences validated in previous literature [21, 22]. gRNA targeting CVH was designed in Geneious Prime (Biomatters Ltd., Auckland, New Zealand) (Table 1) using the reference chicken genome (Gallus_gallus-6.0, GRCg6a) available at the National Center for Biotechnology Information (NCBI). .. For CRISPR/Cas9 plasmid-based genome editing, the plasmid pSpCas9(BB)-2A-Puro (PX459) (#48139, Addgene, MA, USA) was used. gRNA sequences were inserted into the vector by Golden Gate assembly with the BpiI restriction enzyme (#ER1011, Thermo Fisher, MA, USA) and Article Title: Benzalkonium chloride adaptation induces filamentation in Listeria monocytogenes HL06 and enhances its growth in pasteurized milk and pork sausage at 4°C Article Snippet: Benzalkonium chloride (BC) is a commonly used disinfectant in the food industry.. However, inappropriate use of BC leads to BC adaptation in Listeria monocytogenes.. BC adaptation can induce L. monocytogenes filamentation; however, the underlying mechanism remains unclear. Article Title: Atg5-mediated autophagy modulation shapes the outcome of Bombyx mori Nucleopolyhedrovirus infection in silkworms. Article Snippet: Autophagy is a critical cellular process that regulates host–virus interactions, yet its functional dynamics in silkworms during infection with Bombyx mori Nucleopolyhedrovirus (BmNPV) are not fully understood.. This study explored the key role of the autophagy-related gene Atg5 in silkworms during BmNPV infection.. The temporal expression pattern of Atg5 showed a significant increase during the early infection stage (12–24 h) and a significant decrease at later stages (48–72 h) in both BmN cells and larval tissues. Article Title: Functional role of deubiquitinating enzyme USP39 in inhibiting pyroptosis in human acute myeloid leukemia. Article Snippet: Acute myeloid leukemia (AML), a malignant clonal disease derived from hematopoietic stem/progenitor cells, is the most common acute leukemia in adults (Shallis et al. 2019; Döhner et al. 2015). its characteristics encompass the fact that a large number of differentiation-arrested, abnormal primitive myeloid cells proliferate uncontrollably in the bone marrow and other hematopoietic tissues, which in turn impairs normal hematopoietic function (Papaemmanuil et al. 2016).. Despite significant advances in clinical treatment in recent years, the overall prognosis of AML remains unsatisfactory.. Statistics show that the five-year overall survival rate of AML patients is still less than 30%, especially in elderly patients with a worse prognosis (Siegel et al. 2020). Generated:Article Title: Compact Cas12f enables genome editing in avian cells Article Snippet: For Cas9-mediated editing, the plasmids pSpCas9(BB)-2A-GFP (PX458) (#48138, Addgene, MA, USA) and pSpCas9(BB)-2A-Puro (PX459) (#48139, Addgene) were used. .. For Cas12f-mediated editing, the plasmid Cas12f-GE ver4.1(_GFP) (#176544, Addgene) was used, and the Cas12f-GE ver4.1_Puro was generated by replacing the GFP cassette with a puromycin resistance gene through digestion and ligation using EcoRI restriction enzyme (#R0101L, New England Biolabs, MA, USA) and Ligation:Article Title: Compact Cas12f enables genome editing in avian cells Article Snippet: For Cas9-mediated editing, the plasmids pSpCas9(BB)-2A-GFP (PX458) (#48138, Addgene, MA, USA) and pSpCas9(BB)-2A-Puro (PX459) (#48139, Addgene) were used. .. For Cas12f-mediated editing, the plasmid Cas12f-GE ver4.1(_GFP) (#176544, Addgene) was used, and the Cas12f-GE ver4.1_Puro was generated by replacing the GFP cassette with a puromycin resistance gene through digestion and ligation using EcoRI restriction enzyme (#R0101L, New England Biolabs, MA, USA) and Mutagenesis:Article Title: Functional analysis and identification of miRNAs associated with lipid metabolism from milk-derived exosomes Article Snippet: Potential miRNA-binding sites within the target gene 3′-UTRs were predicted using TargetScan (Release 7.2). .. Wild-type (WT) and mutant (MUT) DNA fragments were synthesized (Sangon Biotech) and cloned into NheI/AccI-digested pmirGLO vectors using Synthesized:Article Title: Functional analysis and identification of miRNAs associated with lipid metabolism from milk-derived exosomes Article Snippet: Potential miRNA-binding sites within the target gene 3′-UTRs were predicted using TargetScan (Release 7.2). .. Wild-type (WT) and mutant (MUT) DNA fragments were synthesized (Sangon Biotech) and cloned into NheI/AccI-digested pmirGLO vectors using Clone Assay:Article Title: Functional analysis and identification of miRNAs associated with lipid metabolism from milk-derived exosomes Article Snippet: Potential miRNA-binding sites within the target gene 3′-UTRs were predicted using TargetScan (Release 7.2). .. Wild-type (WT) and mutant (MUT) DNA fragments were synthesized (Sangon Biotech) and cloned into NheI/AccI-digested pmirGLO vectors using Article Title: Atg5-mediated autophagy modulation shapes the outcome of Bombyx mori Nucleopolyhedrovirus infection in silkworms. Article Snippet: Autophagy is a critical cellular process that regulates host–virus interactions, yet its functional dynamics in silkworms during infection with Bombyx mori Nucleopolyhedrovirus (BmNPV) are not fully understood.. This study explored the key role of the autophagy-related gene Atg5 in silkworms during BmNPV infection.. The temporal expression pattern of Atg5 showed a significant increase during the early infection stage (12–24 h) and a significant decrease at later stages (48–72 h) in both BmN cells and larval tissues. Incubation:Article Title: Maize gene ZmRAVL1 and functional site and use thereof Article Snippet: RNAi Targeting Sequences: (SEQ ID No: 45) GGACGAGGAGGAAGAGCAGGAGGAAGAGGAGGAGGAGGAGGAGGCGTCT CCGCGCGAGATCCCCTTCATGACAGCGGCAGCGACGGCCGACACCGGAG CCGCCGCCTCCTCGTCCTCGCCTTCCGCGGCGGCCTCATCGGGTCCTGC TGCTGCCCCCCGCTCGAGCGACGGCGCCGGGGCGTCCGGGAGCGGCGGC GGCGGGAGCGACGACGTGCAGGTGATCGAGAAGGA Primer Names and Sequences RNAi-1-F (SEQ ID No: 46) CGGGATCCCCATGGGGACGAGGAGGAAGAGCA RNAi-1-R (SEQ ID No: 47) GGACTAGTTCCTTCTCGATCACCTGCAC RNAi-2-F (SEQ ID No: 48) GAAGATCTGGTTACCGGACGAGGAGGAAGAGCA RNAi-2-R (SEQ ID No: 49) GCTCTAGATCCTTCTCGATCACCTGCAC (2) E. coli was used to amplify and propagate the P1022 plasmid, and the Bgl II and Xba I (Takara) double digestion system was used to digest the P1022 plasmid and antisense fragments. .. The double digestion system was as follows: Ingredients Amount added plasmid/DNA fragment 5 μg Bgl II 5 μL Xba I 5 μL 10 × T 20 μL ddH2O To 100 μL It was incubated for more than 3 hours in a 37° C. water bath. (3) The digested product was purified using a purification kit (OMEGA), and the antisense fragment was introduced into the P1022 vector using Purification:Article Title: Maize gene ZmRAVL1 and functional site and use thereof Article Snippet: RNAi Targeting Sequences: (SEQ ID No: 45) GGACGAGGAGGAAGAGCAGGAGGAAGAGGAGGAGGAGGAGGAGGCGTCT CCGCGCGAGATCCCCTTCATGACAGCGGCAGCGACGGCCGACACCGGAG CCGCCGCCTCCTCGTCCTCGCCTTCCGCGGCGGCCTCATCGGGTCCTGC TGCTGCCCCCCGCTCGAGCGACGGCGCCGGGGCGTCCGGGAGCGGCGGC GGCGGGAGCGACGACGTGCAGGTGATCGAGAAGGA Primer Names and Sequences RNAi-1-F (SEQ ID No: 46) CGGGATCCCCATGGGGACGAGGAGGAAGAGCA RNAi-1-R (SEQ ID No: 47) GGACTAGTTCCTTCTCGATCACCTGCAC RNAi-2-F (SEQ ID No: 48) GAAGATCTGGTTACCGGACGAGGAGGAAGAGCA RNAi-2-R (SEQ ID No: 49) GCTCTAGATCCTTCTCGATCACCTGCAC (2) E. coli was used to amplify and propagate the P1022 plasmid, and the Bgl II and Xba I (Takara) double digestion system was used to digest the P1022 plasmid and antisense fragments. .. The double digestion system was as follows: Ingredients Amount added plasmid/DNA fragment 5 μg Bgl II 5 μL Xba I 5 μL 10 × T 20 μL ddH2O To 100 μL It was incubated for more than 3 hours in a 37° C. water bath. (3) The digested product was purified using a purification kit (OMEGA), and the antisense fragment was introduced into the P1022 vector using Article Title: Functional role of deubiquitinating enzyme USP39 in inhibiting pyroptosis in human acute myeloid leukemia. Article Snippet: Acute myeloid leukemia (AML), a malignant clonal disease derived from hematopoietic stem/progenitor cells, is the most common acute leukemia in adults (Shallis et al. 2019; Döhner et al. 2015). its characteristics encompass the fact that a large number of differentiation-arrested, abnormal primitive myeloid cells proliferate uncontrollably in the bone marrow and other hematopoietic tissues, which in turn impairs normal hematopoietic function (Papaemmanuil et al. 2016).. Despite significant advances in clinical treatment in recent years, the overall prognosis of AML remains unsatisfactory.. Statistics show that the five-year overall survival rate of AML patients is still less than 30%, especially in elderly patients with a worse prognosis (Siegel et al. 2020). CRISPR:Article Title: Improvement of chicken genome editing efficiency in vitro using ribonucleoprotein-mediated CRISPR/Cas9 delivery. Article Snippet: gRNAs targeting DAZL and STRA8 were designed based on sequences validated in previous literature [21, 22]. gRNA targeting CVH was designed in Geneious Prime (Biomatters Ltd., Auckland, New Zealand) (Table 1) using the reference chicken genome (Gallus_gallus-6.0, GRCg6a) available at the National Center for Biotechnology Information (NCBI). .. For CRISPR/Cas9 plasmid-based genome editing, the plasmid pSpCas9(BB)-2A-Puro (PX459) (#48139, Addgene, MA, USA) was used. gRNA sequences were inserted into the vector by Golden Gate assembly with the BpiI restriction enzyme (#ER1011, Thermo Fisher, MA, USA) and Expressing:Article Title: Atg5-mediated autophagy modulation shapes the outcome of Bombyx mori Nucleopolyhedrovirus infection in silkworms. Article Snippet: Autophagy is a critical cellular process that regulates host–virus interactions, yet its functional dynamics in silkworms during infection with Bombyx mori Nucleopolyhedrovirus (BmNPV) are not fully understood.. This study explored the key role of the autophagy-related gene Atg5 in silkworms during BmNPV infection.. The temporal expression pattern of Atg5 showed a significant increase during the early infection stage (12–24 h) and a significant decrease at later stages (48–72 h) in both BmN cells and larval tissues. Amplification:Article Title: Functional role of deubiquitinating enzyme USP39 in inhibiting pyroptosis in human acute myeloid leukemia. Article Snippet: Acute myeloid leukemia (AML), a malignant clonal disease derived from hematopoietic stem/progenitor cells, is the most common acute leukemia in adults (Shallis et al. 2019; Döhner et al. 2015). its characteristics encompass the fact that a large number of differentiation-arrested, abnormal primitive myeloid cells proliferate uncontrollably in the bone marrow and other hematopoietic tissues, which in turn impairs normal hematopoietic function (Papaemmanuil et al. 2016).. Despite significant advances in clinical treatment in recent years, the overall prognosis of AML remains unsatisfactory.. Statistics show that the five-year overall survival rate of AML patients is still less than 30%, especially in elderly patients with a worse prognosis (Siegel et al. 2020). Transformation Assay:Article Title: Functional role of deubiquitinating enzyme USP39 in inhibiting pyroptosis in human acute myeloid leukemia. Article Snippet: Acute myeloid leukemia (AML), a malignant clonal disease derived from hematopoietic stem/progenitor cells, is the most common acute leukemia in adults (Shallis et al. 2019; Döhner et al. 2015). its characteristics encompass the fact that a large number of differentiation-arrested, abnormal primitive myeloid cells proliferate uncontrollably in the bone marrow and other hematopoietic tissues, which in turn impairs normal hematopoietic function (Papaemmanuil et al. 2016).. Despite significant advances in clinical treatment in recent years, the overall prognosis of AML remains unsatisfactory.. Statistics show that the five-year overall survival rate of AML patients is still less than 30%, especially in elderly patients with a worse prognosis (Siegel et al. 2020). Bacteria:Article Title: Functional role of deubiquitinating enzyme USP39 in inhibiting pyroptosis in human acute myeloid leukemia. Article Snippet: Acute myeloid leukemia (AML), a malignant clonal disease derived from hematopoietic stem/progenitor cells, is the most common acute leukemia in adults (Shallis et al. 2019; Döhner et al. 2015). its characteristics encompass the fact that a large number of differentiation-arrested, abnormal primitive myeloid cells proliferate uncontrollably in the bone marrow and other hematopoietic tissues, which in turn impairs normal hematopoietic function (Papaemmanuil et al. 2016).. Despite significant advances in clinical treatment in recent years, the overall prognosis of AML remains unsatisfactory.. Statistics show that the five-year overall survival rate of AML patients is still less than 30%, especially in elderly patients with a worse prognosis (Siegel et al. 2020). |